| Name | Acacia EST database |
|---|
| Aliases | None |
|---|
| Description | The database contains 6253 EST sequences of Acacia, an economic plant. The database has BLAST search function. |
|---|
| Type | DB |
|---|
| Main Institutes of management | Kyoto University |
|---|
| Country of the Institute | Japan |
|---|
| URL of the site | http://www.rish.kyoto-u.ac.jp/W/LMSFPM/home/blast/blast_search.htm |
|---|
| Interface | GUI |
|---|
| Input example | Input the sample sequence in the text box on the center of the top page, push "submit query" button.>sample_seqgatcaactcgagatgttagaaggtgcaaaactaataggggccggagctgctacaattgctcagcgggagctgctatcggtattggaaacgtccttagttcctcgattcattccgtggct |
|---|
| Keyword | |Acacia mangium | EST | database |
|---|
| Amount of the all data for download（Mbyte） | Method to obtain the all data. | 0|None |
|---|
| External resources (databases) in building the product. | None |
|---|
| Data type | DNA-sequence EST |
|---|
| Biological species in the main concern | Acacia mangium [Taxonomy_id: 224085, eudicots] |
|---|
| Conditions of use | None |
|---|
| Frequency of updates (in last two years) | one time / year |
|---|
| Last date of updates (date of confirmation) | 2010/07/00 (2019/07/03) |
|---|
| Main IDs used in the products | None |
|---|
| How to make a link to get access to each IDs. | None |
|---|
| external databases to which this database/tool have links | None |
|---|
| Published papers (PubMed IDs) | Shiro Suzuki, Kunihiro Suda, Nozomu Sakurai, Yoshiyuki Ogata, Takefumi Hattori, Hideyuki Suzuki, Daisuke Shibata, Toshiaki Umezawa (2010) Analysis of expressed sequence tags in developing secondary xylem and shoot of Acacia mangium. Journal of Wood Science. |
|---|
| Operational Status | available |
|---|
