Database

Acacia EST database

noimage
NameAcacia EST database
AliasesNone
Description"The database contains 6253 EST sequences of Acacia, an economic plant. The database has BLAST search function."
TypeDB
Main Institutes of managementKyoto University
Country of the InstituteJapan
URL of the sitehttp://www.rish.kyoto-u.ac.jp/W/LMSFPM/home/blast/blast_search.htm
InterfaceGUI
Input example"Input the sample sequence in the text box on the center of the top page, push "submit query" button.>sample_seqgatcaactcgagatgttagaaggtgcaaaactaataggggccggagctgctacaattgctcagcgggagctgctatcggtattggaaacgtccttagttcctcgattcattccgtggct"
Keyword|Acacia mangium | EST | database
Amount of the all data for download(Mbyte) | Method to obtain the all data.0|None
External resources (databases) in building the product.None
Data typeDNA-sequence EST
Biological species in the main concern"Acacia mangium [Taxonomy_id: 224085, eudicots]"
Conditions of useNone
Frequency of updates (in last two years)one time / year
Last date of updates (date of confirmation)2010/07/00 (2019/07/03)
Main IDs used in the productsNone
How to make a link to get access to each IDs.None
external databases to which this database/tool have linksNone
Published papers (PubMed IDs)Shiro Suzuki, Kunihiro Suda, Nozomu Sakurai, Yoshiyuki Ogata, Takefumi Hattori, Hideyuki Suzuki, Daisuke Shibata, Toshiaki Umezawa (2010) Analysis of expressed sequence tags in developing secondary xylem and shoot of Acacia mangium. Journal of Wood Science.
Operational Statusavailable