Name Acacia EST database
Aliases None
Description

"The database contains 6253 EST sequences of Acacia, an economic plant. The database has BLAST search function."

Type DB
Main Institutes of management Kyoto University
Country of the Institute Japan
URL of the site http://www.rish.kyoto-u.ac.jp/W/LMSFPM/home/blast/blast_search.htm
Interface GUI
Input example

"Input the sample sequence in the text box on the center of the top page, push "submit query" button.>sample_seqgatcaactcgagatgttagaaggtgcaaaactaataggggccggagctgctacaattgctcagcgggagctgctatcggtattggaaacgtccttagttcctcgattcattccgtggct"

Keyword
|Acacia mangium | EST | database
Amount of the all data for download(Mbyte) | Method to obtain the all data. 0|None
External resources (databases) in building the product. None
Data type DNA-sequence EST
Biological species in the main concern
"Acacia mangium [Taxonomy_id: 224085, eudicots]"
Conditions of use None
Frequency of updates (in last two years) one time / year
Last date of updates (date of confirmation) 2010/07/00 (2019/07/03)
Main IDs used in the products None
How to make a link to get access to each IDs. None
external databases to which this database/tool have links

None

Published papers (PubMed IDs)

Shiro Suzuki, Kunihiro Suda, Nozomu Sakurai, Yoshiyuki Ogata, Takefumi Hattori, Hideyuki Suzuki, Daisuke Shibata, Toshiaki Umezawa (2010) Analysis of expressed sequence tags in developing secondary xylem and shoot of Acacia mangium. Journal of Wood Science.

Operational Status

available